Transcript: Human NM_001204299.3

Homo sapiens ZNF664-RFLNA readthrough (ZNF664-RFLNA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF664-RFLNA (100533183)
Length:
2413
CDS:
507..914

Additional Resources:

NCBI RefSeq record:
NM_001204299.3
NBCI Gene record:
ZNF664-RFLNA (100533183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263831 GAGCTCAGCTGTCGGTTTAAA pLKO_005 1826 3UTR 100% 15.000 7.500 Y RFLNA n/a
2 TRCN0000263833 GTACGCCTCGGAGAAGCATTT pLKO_005 599 CDS 100% 10.800 5.400 Y RFLNA n/a
3 TRCN0000282826 CAAGCATGCCAGGAGCACTTT pLKO_005 779 CDS 100% 4.950 2.475 Y RFLNA n/a
4 TRCN0000172961 GAGAAGCATTTCCAGGACAAG pLKO.1 609 CDS 100% 4.050 2.025 Y RFLNA n/a
5 TRCN0000263832 CAGGACAAGGTCTTCTATGCG pLKO_005 621 CDS 100% 2.640 1.320 Y RFLNA n/a
6 TRCN0000172744 GAAGCATTTCCAGGACAAGGT pLKO.1 611 CDS 100% 2.640 1.320 Y RFLNA n/a
7 TRCN0000282823 ACGCATGAGATCCGCTGCAAC pLKO_005 567 CDS 100% 1.350 0.675 Y RFLNA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.