Transcript: Human NM_001204317.1

Homo sapiens prolactin receptor (PRLR), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PRLR (5618)
Length:
1631
CDS:
106..972

Additional Resources:

NCBI RefSeq record:
NM_001204317.1
NBCI Gene record:
PRLR (5618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373248 CCTGTATGAAATTCGATTAAA pLKO_005 603 CDS 100% 15.000 21.000 N PRLR n/a
2 TRCN0000059109 CCTAGTGACTTCACCATGAAT pLKO.1 784 CDS 100% 5.625 3.938 N PRLR n/a
3 TRCN0000059112 CCAGCGACCTTCATTCAGATA pLKO.1 763 CDS 100% 4.950 3.465 N PRLR n/a
4 TRCN0000059111 CTACCAATTATTCACTGACTT pLKO.1 275 CDS 100% 4.950 3.465 N PRLR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.