Transcript: Human NM_001204527.2

Homo sapiens signal sequence receptor subunit 4 (SSR4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SSR4 (6748)
Length:
778
CDS:
167..712

Additional Resources:

NCBI RefSeq record:
NM_001204527.2
NBCI Gene record:
SSR4 (6748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053779 CAGGCACCTATGAGGTTAGAT pLKO.1 486 CDS 100% 5.625 7.875 N SSR4 n/a
2 TRCN0000053781 GACCGTCTTCATTGTGGAGAT pLKO.1 328 CDS 100% 4.050 5.670 N SSR4 n/a
3 TRCN0000053782 GTCCAGAACATGGCTCTCTAT pLKO.1 371 CDS 100% 4.950 3.960 N SSR4 n/a
4 TRCN0000053778 CCACTTCTGACGCTGTCATTT pLKO.1 300 CDS 100% 13.200 9.240 N SSR4 n/a
5 TRCN0000053780 CAGAGGAATAACGAGGACATT pLKO.1 545 CDS 100% 4.950 3.465 N SSR4 n/a
6 TRCN0000431257 CTATGCTGACGTCGGTGGAAA pLKO_005 388 CDS 100% 4.950 3.465 N SSR4 n/a
7 TRCN0000417121 GATCTCCCTGACATGCAAGAA pLKO_005 346 CDS 100% 4.950 3.465 N SSR4 n/a
8 TRCN0000412873 CATTTCCACTGAGACCGTCTT pLKO_005 316 CDS 100% 4.050 2.835 N SSR4 n/a
9 TRCN0000430662 TCTTCGACGAGGAGTCCTACA pLKO_005 507 CDS 100% 4.050 2.835 N SSR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.