Transcript: Human NM_001204760.2

Homo sapiens tolloid like 1 (TLL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TLL1 (7092)
Length:
2333
CDS:
669..1847

Additional Resources:

NCBI RefSeq record:
NM_001204760.2
NBCI Gene record:
TLL1 (7092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373696 ATATGGCCTGGAGGCGTTATT pLKO_005 1134 CDS 100% 13.200 9.240 N TLL1 n/a
2 TRCN0000054110 GCCTTAGATGATGAAGACTTA pLKO.1 858 CDS 100% 4.950 3.465 N TLL1 n/a
3 TRCN0000054108 CCGCTACATCAAGAACGGAAA pLKO.1 1111 CDS 100% 4.050 2.835 N TLL1 n/a
4 TRCN0000031410 GCCTCGATTATGATTACACTT pLKO.1 757 CDS 100% 4.950 2.970 N Tll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204760.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.