Transcript: Human NM_001204872.2

Homo sapiens aminopeptidase like 1 (NPEPL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NPEPL1 (79716)
Length:
2128
CDS:
123..1610

Additional Resources:

NCBI RefSeq record:
NM_001204872.2
NBCI Gene record:
NPEPL1 (79716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051737 CTCAGGGAAGACGGTGGAAAT pLKO.1 1031 CDS 100% 10.800 5.400 Y NPEPL1 n/a
2 TRCN0000288961 CTCAGGGAAGACGGTGGAAAT pLKO_005 1031 CDS 100% 10.800 5.400 Y NPEPL1 n/a
3 TRCN0000051734 GCAATCAAGCAGGGTTTCAAA pLKO.1 927 CDS 100% 5.625 2.813 Y NPEPL1 n/a
4 TRCN0000288892 GCAATCAAGCAGGGTTTCAAA pLKO_005 927 CDS 100% 5.625 2.813 Y NPEPL1 n/a
5 TRCN0000051733 GCTTGTTTCTGTTTGTTACTT pLKO.1 1811 3UTR 100% 5.625 2.813 Y NPEPL1 n/a
6 TRCN0000288960 GCTTGTTTCTGTTTGTTACTT pLKO_005 1811 3UTR 100% 5.625 2.813 Y NPEPL1 n/a
7 TRCN0000051736 CACACCCTGCAATGAGATGAA pLKO.1 596 CDS 100% 4.950 2.475 Y NPEPL1 n/a
8 TRCN0000288959 CACACCCTGCAATGAGATGAA pLKO_005 596 CDS 100% 4.950 2.475 Y NPEPL1 n/a
9 TRCN0000051735 GACGAGAGGATTTGGAGGAAT pLKO.1 701 CDS 100% 4.950 2.475 Y NPEPL1 n/a
10 TRCN0000288958 GACGAGAGGATTTGGAGGAAT pLKO_005 701 CDS 100% 4.950 2.475 Y NPEPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204872.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.