Transcript: Mouse NM_001205076.1

Mus musculus junctophilin 2 (Jph2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Jph2 (59091)
Length:
4155
CDS:
368..2458

Additional Resources:

NCBI RefSeq record:
NM_001205076.1
NBCI Gene record:
Jph2 (59091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415197 TCCAACATCGCCCGTACATTG pLKO_005 1583 CDS 100% 10.800 15.120 N Jph2 n/a
2 TRCN0000125271 CCGCCACAATGTGCTGGTCAA pLKO.1 1372 CDS 100% 1.350 1.080 N Jph2 n/a
3 TRCN0000125273 AGGAACCTATCAAGGCCAATT pLKO.1 745 CDS 100% 10.800 7.560 N Jph2 n/a
4 TRCN0000423179 GAATCCGGCAGAGCACAAACA pLKO_005 651 CDS 100% 4.950 3.465 N Jph2 n/a
5 TRCN0000125270 CGTCCTCATCTGTATGGTGAT pLKO.1 2389 CDS 100% 4.050 2.835 N Jph2 n/a
6 TRCN0000125269 GCCAGGAGTTCCACTGAGGAT pLKO.1 2474 3UTR 100% 0.880 0.616 N Jph2 n/a
7 TRCN0000125272 TGGGAATACCTTTGAGGGATA pLKO.1 535 CDS 100% 4.050 2.430 N Jph2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.