Transcript: Mouse NM_001205173.1

Mus musculus intermediate filament family orphan 2 (Iffo2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Iffo2 (212632)
Length:
5732
CDS:
229..1767

Additional Resources:

NCBI RefSeq record:
NM_001205173.1
NBCI Gene record:
Iffo2 (212632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246599 CGAATCGATATCACGGCTAAG pLKO_005 1102 CDS 100% 6.000 8.400 N Iffo2 n/a
2 TRCN0000182157 CCGAATCGATATCACGGCTAA pLKO.1 1101 CDS 100% 4.050 5.670 N Iffo2 n/a
3 TRCN0000246602 TCATACACTTCTGGTTATTAT pLKO_005 3564 3UTR 100% 15.000 10.500 N Iffo2 n/a
4 TRCN0000246600 CTCAGGAAGTACAGACGAAAT pLKO_005 1698 CDS 100% 10.800 7.560 N Iffo2 n/a
5 TRCN0000253660 CTTGATCCATGAGACCGAATC pLKO_005 1458 CDS 100% 6.000 4.200 N IFFO2 n/a
6 TRCN0000246601 ACCGACACCTTCATGAGTATA pLKO_005 1562 CDS 100% 13.200 7.920 N Iffo2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4493 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.