Transcript: Mouse NM_001205235.1

Mus musculus neurexin II (Nrxn2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Nrxn2 (18190)
Length:
6077
CDS:
480..4991

Additional Resources:

NCBI RefSeq record:
NM_001205235.1
NBCI Gene record:
Nrxn2 (18190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094488 CCCTACATGGACCAATGCAAA pLKO.1 3105 CDS 100% 4.950 3.960 N Nrxn2 n/a
2 TRCN0000140984 CAATGGCAAGTTCAACGACAA pLKO.1 1571 CDS 100% 4.050 3.240 N NRXN2 n/a
3 TRCN0000094487 CCCGGCAGGAAACTTTGATAA pLKO.1 4184 CDS 100% 13.200 9.240 N Nrxn2 n/a
4 TRCN0000446907 CTCACAGCCCTGGGTTGATTT pLKO_005 5251 3UTR 100% 13.200 9.240 N NRXN2 n/a
5 TRCN0000094485 GCCCGAAATCTGGATCTCAAA pLKO.1 3522 CDS 100% 4.950 3.465 N Nrxn2 n/a
6 TRCN0000094486 CGCAAGGTCAATGATGGTGAA pLKO.1 2175 CDS 100% 4.050 2.835 N Nrxn2 n/a
7 TRCN0000094484 CGTTCGTTTATTTCCCTCGAT pLKO.1 5352 3UTR 100% 2.640 1.848 N Nrxn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205235.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.