Transcript: Mouse NM_001205282.1

Mus musculus predicted gene 14496 (Gm14496), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
Gm14496 (672125)
Length:
2550
CDS:
1..2550

Additional Resources:

NCBI RefSeq record:
NM_001205282.1
NBCI Gene record:
Gm14496 (672125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001205282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257361 CAGACCACATTTGGAGTATTT pLKO_005 1954 CDS 100% 13.200 6.600 Y Gm20783 n/a
2 TRCN0000028028 CCCTTTATTGACAGAGATATA pLKO.1 2155 CDS 100% 13.200 6.600 Y Vmn2r122 n/a
3 TRCN0000104930 CCTCCCTTTATTGACAGAGAT pLKO.1 2152 CDS 100% 4.950 2.475 Y Vmn2r122 n/a
4 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 495 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
5 TRCN0000188910 GCTTTCAAGCTCACTACTCCA pLKO.1 2026 CDS 100% 2.640 1.320 Y LOC436147 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.