Transcript: Human NM_001205317.2

Homo sapiens regulating synaptic membrane exocytosis 4 (RIMS4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
RIMS4 (140730)
Length:
5414
CDS:
276..1088

Additional Resources:

NCBI RefSeq record:
NM_001205317.2
NBCI Gene record:
RIMS4 (140730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007017 CATCTACTTCCCGTGCATGAA pLKO.1 329 CDS 100% 4.950 6.930 N RIMS4 n/a
2 TRCN0000007018 CGGTCAGTTGGAGGTGGACAT pLKO.1 659 CDS 100% 1.350 1.890 N RIMS4 n/a
3 TRCN0000007014 CGGAAATTCTTCCCTTCCCTT pLKO.1 2851 3UTR 100% 2.640 2.112 N RIMS4 n/a
4 TRCN0000428878 AGTCGCTGGACCCACTGTATA pLKO_005 802 CDS 100% 13.200 9.240 N RIMS4 n/a
5 TRCN0000243906 CAGAGGGCAACCTTAACTATG pLKO_005 505 CDS 100% 10.800 7.560 N Rims4 n/a
6 TRCN0000007015 ACCTTAACTATGGAGGAGTTT pLKO.1 514 CDS 100% 4.950 3.465 N RIMS4 n/a
7 TRCN0000420535 GATGGAGCGGAAGCAGTTCAT pLKO_005 896 CDS 100% 4.950 3.465 N RIMS4 n/a
8 TRCN0000007016 GAATGGCATCTGCATTGCCAA pLKO.1 758 CDS 100% 0.264 0.185 N RIMS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.