Transcript: Human NM_001206838.2

Homo sapiens protein tyrosine phosphatase receptor type Z1 (PTPRZ1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PTPRZ1 (5803)
Length:
5523
CDS:
340..4707

Additional Resources:

NCBI RefSeq record:
NM_001206838.2
NBCI Gene record:
PTPRZ1 (5803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001206838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356375 CAATCGCATAGGGACGAAATA pLKO_005 1740 CDS 100% 13.200 18.480 N PTPRZ1 n/a
2 TRCN0000356299 ACATATCCCAAGGGTATATAT pLKO_005 2144 CDS 100% 15.000 12.000 N PTPRZ1 n/a
3 TRCN0000002915 GCTGCTTTAGATCCATTCATA pLKO.1 967 CDS 100% 5.625 4.500 N PTPRZ1 n/a
4 TRCN0000368441 ACGAAGGAACTGTCAACATAT pLKO_005 3623 CDS 100% 13.200 9.240 N PTPRZ1 n/a
5 TRCN0000002917 CGTAGTTCATTAGCTGGTCTT pLKO.1 5307 3UTR 100% 4.050 2.835 N PTPRZ1 n/a
6 TRCN0000002916 GCCTATAAATTGTGAGAGCTT pLKO.1 4179 CDS 100% 2.640 1.848 N PTPRZ1 n/a
7 TRCN0000010747 CCAGACAACAAGCACAAGAAT pLKO.1 3001 CDS 100% 5.625 3.375 N PTPRZ1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 171 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001206838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.