Transcript: Human NM_001207047.3

Homo sapiens attractin (ATRN), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ATRN (8455)
Length:
3739
CDS:
56..3526

Additional Resources:

NCBI RefSeq record:
NM_001207047.3
NBCI Gene record:
ATRN (8455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062500 GCGATACTGTTGAATGTGAAT pLKO.1 504 CDS 100% 4.950 6.930 N ATRN n/a
2 TRCN0000291359 GCGATACTGTTGAATGTGAAT pLKO_005 504 CDS 100% 4.950 6.930 N ATRN n/a
3 TRCN0000062502 GCCCTCTCTATGGATATATAA pLKO.1 1110 CDS 100% 15.000 10.500 N ATRN n/a
4 TRCN0000291312 GCCCTCTCTATGGATATATAA pLKO_005 1110 CDS 100% 15.000 10.500 N ATRN n/a
5 TRCN0000062498 CCCAGGAAGATGATCGCTATT pLKO.1 3216 CDS 100% 10.800 7.560 N ATRN n/a
6 TRCN0000291358 CCCAGGAAGATGATCGCTATT pLKO_005 3216 CDS 100% 10.800 7.560 N ATRN n/a
7 TRCN0000062501 CCACCCAAATATCACTTTCTT pLKO.1 3448 CDS 100% 5.625 3.938 N ATRN n/a
8 TRCN0000111001 GCCAGCTATGTGAGGTAGAAA pLKO.1 3117 CDS 100% 5.625 3.938 N Atrn n/a
9 TRCN0000062499 GCCAAGGAGAATTATGACAAT pLKO.1 2120 CDS 100% 4.950 3.465 N ATRN n/a
10 TRCN0000291360 GCCAAGGAGAATTATGACAAT pLKO_005 2120 CDS 100% 4.950 3.465 N ATRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.