Transcript: Human NM_001207056.2

Homo sapiens DNA methyltransferase 3 beta (DNMT3B), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DNMT3B (1789)
Length:
3859
CDS:
322..2406

Additional Resources:

NCBI RefSeq record:
NM_001207056.2
NBCI Gene record:
DNMT3B (1789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001207056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414235 AGCCTAACACGGTGCTCATTT pLKO_005 2628 3UTR 100% 13.200 18.480 N DNMT3B n/a
2 TRCN0000424360 GACGATGGCTATCAGTCTTAC pLKO_005 1444 CDS 100% 10.800 15.120 N DNMT3B n/a
3 TRCN0000035684 GCCTCAAGACAAATTGCTATA pLKO.1 1226 CDS 100% 10.800 15.120 N DNMT3B n/a
4 TRCN0000419070 TCACGGTTCCTGGAGTGTAAT pLKO_005 2164 CDS 100% 13.200 10.560 N DNMT3B n/a
5 TRCN0000035686 CCATGCAACGATCTCTCAAAT pLKO.1 1981 CDS 100% 13.200 9.240 N DNMT3B n/a
6 TRCN0000437183 AGTGCCGACAGCTCTCCAATA pLKO_005 2758 3UTR 100% 10.800 7.560 N DNMT3B n/a
7 TRCN0000418133 AGTAGGTAGCAACGTGGCTTT pLKO_005 2677 3UTR 100% 4.050 2.835 N DNMT3B n/a
8 TRCN0000035688 CCTGTCATTGTTTGATGGCAT pLKO.1 1764 CDS 100% 2.640 1.848 N DNMT3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001207056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.