Transcript: Mouse NM_001242388.1

Mus musculus zinc finger protein 976 (Zfp976), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp976 (208111)
Length:
5011
CDS:
123..2033

Additional Resources:

NCBI RefSeq record:
NM_001242388.1
NBCI Gene record:
Zfp976 (208111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001242388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218903 GCCTATTCACACCAGAAATAT pLKO_005 1041 CDS 100% 15.000 10.500 N Zfp976 n/a
2 TRCN0000229563 ACATGATAGCAGCCAACTATT pLKO_005 4597 3UTR 100% 13.200 9.240 N Zfp976 n/a
3 TRCN0000229562 CAATCCCACTATCTTCGAATG pLKO_005 1554 CDS 100% 6.000 3.600 N Zfp976 n/a
4 TRCN0000229561 GAAATATCTCCAAATACATGA pLKO_005 1055 CDS 100% 4.950 2.970 N Zfp976 n/a
5 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2178 3UTR 100% 15.000 7.500 Y Gm10771 n/a
6 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2178 3UTR 100% 15.000 7.500 Y ZNF286B n/a
7 TRCN0000218169 CAGCTCAAGTATCTTCGATTA pLKO_005 1302 CDS 100% 10.800 5.400 Y Zfp976 n/a
8 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 3635 3UTR 100% 5.625 2.813 Y ZNF345 n/a
9 TRCN0000096056 GCCTTCAAATATCACAGTCAT pLKO.1 369 CDS 100% 4.950 2.475 Y Zfp975 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1340 CDS 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242388.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.