Transcript: Human NM_001242814.1

Homo sapiens ankyrin repeat domain 6 (ANKRD6), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-10-09
Taxon:
Homo sapiens (human)
Gene:
ANKRD6 (22881)
Length:
4961
CDS:
140..2131

Additional Resources:

NCBI RefSeq record:
NM_001242814.1
NBCI Gene record:
ANKRD6 (22881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001242814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158616 CCAAGGAGTCAACTATTGTAT pLKO.1 2201 3UTR 100% 5.625 7.875 N ANKRD6 n/a
2 TRCN0000162328 CCCAAGGAGTCAACTATTGTA pLKO.1 2200 3UTR 100% 5.625 7.875 N ANKRD6 n/a
3 TRCN0000161870 GCATGCTCATAATCACCCTAA pLKO.1 1057 CDS 100% 4.050 5.670 N ANKRD6 n/a
4 TRCN0000163262 GCAGAGCTAAATCCACACCAT pLKO.1 1533 CDS 100% 2.640 3.696 N ANKRD6 n/a
5 TRCN0000160941 GCTTTCTGTTCTGTCCATGAA pLKO.1 626 CDS 100% 4.950 3.960 N ANKRD6 n/a
6 TRCN0000160756 CATCTACTTGTGTGGACCAAT pLKO.1 1551 CDS 100% 4.950 3.465 N ANKRD6 n/a
7 TRCN0000160562 CTAATCAACAAGCTGGAGAAT pLKO.1 1211 CDS 100% 4.950 3.465 N ANKRD6 n/a
8 TRCN0000163365 GCTGTTTCTACCCAGATGGAA pLKO.1 1967 CDS 100% 3.000 2.100 N ANKRD6 n/a
9 TRCN0000159706 GAAGTTTGAAAGCTCAGATTA pLKO.1 2391 3UTR 100% 13.200 7.920 N ANKRD6 n/a
10 TRCN0000082090 GCCCTAAATCACAAGAAGGTA pLKO.1 686 CDS 100% 3.000 2.400 N Ankrd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001242814.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.