Transcript: Human NM_001243182.1

Homo sapiens ATPase copper transporting beta (ATP7B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ATP7B (540)
Length:
6322
CDS:
158..4222

Additional Resources:

NCBI RefSeq record:
NM_001243182.1
NBCI Gene record:
ATP7B (540)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303552 TGACCGGTTTAGTGGATATTT pLKO_005 2575 CDS 100% 15.000 21.000 N ATP7B n/a
2 TRCN0000303554 TTATCGGTCCACGGGATATTA pLKO_005 1659 CDS 100% 15.000 21.000 N ATP7B n/a
3 TRCN0000369653 CATGGCCTTAATGATCTATAT pLKO_005 1816 CDS 100% 13.200 10.560 N ATP7B n/a
4 TRCN0000101609 CCTGTGTGTCTAACATAGAAA pLKO.1 1326 CDS 100% 5.625 4.500 N Atp7b n/a
5 TRCN0000303481 GACCTCTGCTTGGAGTATTTA pLKO_005 4520 3UTR 100% 15.000 10.500 N ATP7B n/a
6 TRCN0000369652 ACATGGCTCTGTGCTCATTAA pLKO_005 2461 CDS 100% 13.200 9.240 N ATP7B n/a
7 TRCN0000043202 GCAACAGGTTTGCCATCAAAT pLKO.1 484 CDS 100% 13.200 9.240 N ATP7B n/a
8 TRCN0000303555 TCTACGTTCAGGCCTACAAAT pLKO_005 1965 CDS 100% 13.200 9.240 N ATP7B n/a
9 TRCN0000043200 CCCATGCTCTTTGTGTTCATT pLKO.1 2126 CDS 100% 5.625 3.938 N ATP7B n/a
10 TRCN0000043201 GCAGCTCAAGTGCTATAAGAA pLKO.1 3937 CDS 100% 5.625 3.938 N ATP7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243182.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.