Transcript: Human NM_001243812.2

Homo sapiens calcium voltage-gated channel subunit alpha1 B (CACNA1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CACNA1B (774)
Length:
9605
CDS:
153..6866

Additional Resources:

NCBI RefSeq record:
NM_001243812.2
NBCI Gene record:
CACNA1B (774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001243812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417463 TTACTCTAGACGACGAATAAA pLKO_005 7137 3UTR 100% 15.000 21.000 N CACNA1B n/a
2 TRCN0000044657 CGAGGACATGACTGTTCACTT pLKO.1 5504 CDS 100% 4.950 6.930 N CACNA1B n/a
3 TRCN0000044655 GCCCTATTTCATCGGGATCTT pLKO.1 554 CDS 100% 4.950 6.930 N CACNA1B n/a
4 TRCN0000044656 GCGCATCAGTTACAATGACAT pLKO.1 5378 CDS 100% 4.950 6.930 N CACNA1B n/a
5 TRCN0000436845 CTTCACCCTGGAGCCTATTTC pLKO_005 3777 CDS 100% 13.200 9.240 N CACNA1B n/a
6 TRCN0000044653 GCCACCAAGAAGAGCAGAAAT pLKO.1 1410 CDS 100% 13.200 9.240 N CACNA1B n/a
7 TRCN0000044654 CCAGTATAAGACGTGGACATT pLKO.1 4532 CDS 100% 4.950 3.465 N CACNA1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.