Transcript: Mouse NM_001243837.1

Mus musculus complement component 7 (C7), mRNA.

Source:
NCBI, updated 2015-12-24
Taxon:
Mus musculus (mouse)
Gene:
C7 (109828)
Length:
2709
CDS:
112..2649

Additional Resources:

NCBI RefSeq record:
NM_001243837.1
NBCI Gene record:
C7 (109828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001243837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067223 CGACGGTTAATCGATCAGTAT pLKO.1 985 CDS 100% 4.950 6.930 N C7 n/a
2 TRCN0000067224 CCGAGATGAGAGTAGAAACAA pLKO.1 2301 CDS 100% 5.625 4.500 N C7 n/a
3 TRCN0000067225 CCAGTGTCTGTGCAAACCATA pLKO.1 1530 CDS 100% 4.950 3.465 N C7 n/a
4 TRCN0000067226 CCTGTGTTCAAGGGAAGAGAA pLKO.1 1643 CDS 100% 4.950 3.465 N C7 n/a
5 TRCN0000057175 GCATCAGCAAATCATTGGTTT pLKO.1 398 CDS 100% 4.950 3.465 N C7 n/a
6 TRCN0000067227 GTGTGCTTTATAGCAGCGTTT pLKO.1 139 CDS 100% 4.050 2.835 N C7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001243837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.