Transcript: Human NM_001244583.1

Homo sapiens transcription factor EC (TFEC), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TFEC (22797)
Length:
6309
CDS:
64..906

Additional Resources:

NCBI RefSeq record:
NM_001244583.1
NBCI Gene record:
TFEC (22797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016101 CCAAGTAGTCTACCAATGAAA pLKO.1 211 CDS 100% 5.625 7.875 N TFEC n/a
2 TRCN0000016100 CCAAAGTCTAATGATCCTGAT pLKO.1 361 CDS 100% 4.050 3.240 N TFEC n/a
3 TRCN0000016098 CGGAGTCCAAATCCACTTAAA pLKO.1 1126 3UTR 100% 13.200 9.240 N TFEC n/a
4 TRCN0000425538 TCACTTGGCACGGTTGATTTA pLKO_005 571 CDS 100% 13.200 9.240 N TFEC n/a
5 TRCN0000016102 CCTTTGTCATACTTCACAGAT pLKO.1 715 CDS 100% 4.950 3.465 N TFEC n/a
6 TRCN0000016099 GCTGCATTGAAAGAGGAACAA pLKO.1 748 CDS 100% 4.950 3.465 N TFEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.