Transcript: Human NM_001244682.2

Homo sapiens POU class 2 homeobox 3 (POU2F3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POU2F3 (25833)
Length:
2906
CDS:
37..1353

Additional Resources:

NCBI RefSeq record:
NM_001244682.2
NBCI Gene record:
POU2F3 (25833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016691 CCGGCCACTTACAGTCTGTAT pLKO.1 344 CDS 100% 4.950 3.960 N POU2F3 n/a
2 TRCN0000016689 CCGATGGAATCATTCCACCTA pLKO.1 1323 CDS 100% 2.640 2.112 N POU2F3 n/a
3 TRCN0000426054 TTCAAGCAGAGGCGCATTAAG pLKO_005 634 CDS 100% 13.200 9.240 N POU2F3 n/a
4 TRCN0000415091 TCACTGTGGCAATAGTCTTTC pLKO_005 1647 3UTR 100% 10.800 7.560 N POU2F3 n/a
5 TRCN0000016690 CTAGATTTCAACAGGCAGATT pLKO.1 157 CDS 100% 4.950 3.465 N POU2F3 n/a
6 TRCN0000016692 GAAACCAAATGTCTGGGCTAA pLKO.1 263 CDS 100% 4.050 2.835 N POU2F3 n/a
7 TRCN0000016688 GCCTCAGTGAAGTATTTGGTA pLKO.1 860 CDS 100% 3.000 1.800 N POU2F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244682.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.