Transcript: Mouse NM_001244916.1

Mus musculus sal-like 2 (Drosophila) (Sall2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sall2 (50524)
Length:
4771
CDS:
215..3223

Additional Resources:

NCBI RefSeq record:
NM_001244916.1
NBCI Gene record:
Sall2 (50524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001244916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234107 GGGCAATTTGCGCGCACATTT pLKO_005 2215 CDS 100% 13.200 18.480 N Sall2 n/a
2 TRCN0000098209 CCCACCGGTAATGGTGATAAT pLKO.1 385 CDS 100% 13.200 10.560 N Sall2 n/a
3 TRCN0000234105 TGCCAAATGCTGCGCACAATT pLKO_005 316 CDS 100% 13.200 10.560 N Sall2 n/a
4 TRCN0000234106 CCACCGGTAATGGTGATAATT pLKO_005 386 CDS 100% 15.000 10.500 N Sall2 n/a
5 TRCN0000234108 TGTAGTGAGATGTAGTATTTA pLKO_005 4562 3UTR 100% 15.000 10.500 N Sall2 n/a
6 TRCN0000218200 GATGCAGATGACTGAACAAAT pLKO_005 796 CDS 100% 13.200 9.240 N Sall2 n/a
7 TRCN0000098208 CCCTTCCCTTATGTGCTAGAA pLKO.1 1925 CDS 100% 4.950 3.465 N Sall2 n/a
8 TRCN0000151157 GAGATGGACAGTAATGAGAAA pLKO.1 2669 CDS 100% 4.950 3.465 N SALL2 n/a
9 TRCN0000098207 GCCACTCTTCACTTGTGTCTT pLKO.1 3010 CDS 100% 4.950 3.465 N Sall2 n/a
10 TRCN0000098206 GCTCCCTACTTTCAACAAGTT pLKO.1 1717 CDS 100% 4.950 3.465 N Sall2 n/a
11 TRCN0000098205 CGGAAGAAAGAAGAAACTATA pLKO.1 3867 3UTR 100% 13.200 7.920 N Sall2 n/a
12 TRCN0000093081 GATGAGGAAGAGGAGGAAGAA pLKO.1 2507 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.