Transcript: Human NM_001244950.2

Homo sapiens SPARC (osteonectin), cwcv and kazal like domains proteoglycan 2 (SPOCK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SPOCK2 (9806)
Length:
5224
CDS:
224..1498

Additional Resources:

NCBI RefSeq record:
NM_001244950.2
NBCI Gene record:
SPOCK2 (9806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001244950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053300 CCGATGGCAAACCAGAGACTT pLKO.1 798 CDS 100% 4.950 6.930 N SPOCK2 n/a
2 TRCN0000373647 CGAAGTGGAGGATGACTATAT pLKO_005 412 CDS 100% 13.200 9.240 N SPOCK2 n/a
3 TRCN0000373572 GTGTGGCATGCGCTGACAAAT pLKO_005 1716 3UTR 100% 13.200 9.240 N SPOCK2 n/a
4 TRCN0000373573 TTCGAGAACGGATCCAGAAAT pLKO_005 1563 3UTR 100% 13.200 9.240 N SPOCK2 n/a
5 TRCN0000053302 CAAGAAGAAGCCAGGCATCTT pLKO.1 1201 CDS 100% 4.950 3.465 N SPOCK2 n/a
6 TRCN0000174224 CAAGAAGAAGCCAGGCATCTT pLKO.1 1201 CDS 100% 4.950 3.465 N SPOCK2 n/a
7 TRCN0000053301 CATGTGCATCAGTCGCAAGAA pLKO.1 550 CDS 100% 4.950 3.465 N SPOCK2 n/a
8 TRCN0000174225 CATGTGCATCAGTCGCAAGAA pLKO.1 550 CDS 100% 4.950 3.465 N SPOCK2 n/a
9 TRCN0000053298 GAGGACAATCAGCAAGGAGAT pLKO.1 443 CDS 100% 4.050 2.835 N SPOCK2 n/a
10 TRCN0000053299 CCATGGAAACAAAGACTCCAT pLKO.1 607 CDS 100% 0.264 0.185 N SPOCK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001244950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.