Transcript: Mouse NM_001252222.1

Mus musculus neighbor of Brca1 gene 1 (Nbr1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Nbr1 (17966)
Length:
4571
CDS:
495..3350

Additional Resources:

NCBI RefSeq record:
NM_001252222.1
NBCI Gene record:
Nbr1 (17966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238310 GACCTGAGTGGGACCCAATTT pLKO_005 2310 CDS 100% 13.200 10.560 N Nbr1 n/a
2 TRCN0000123386 CCCATCTCTTTGAAATGGGAT pLKO.1 3214 CDS 100% 0.264 0.211 N Nbr1 n/a
3 TRCN0000238308 CCTTTGAGCTGCTGGATATAA pLKO_005 2182 CDS 100% 15.000 10.500 N Nbr1 n/a
4 TRCN0000238309 AGAAGTCTCAATGCCTATTTC pLKO_005 1076 CDS 100% 13.200 9.240 N Nbr1 n/a
5 TRCN0000123388 GCAGAGGTCAAAGAGCTTAAA pLKO.1 1437 CDS 100% 13.200 9.240 N Nbr1 n/a
6 TRCN0000238307 ACTGGTACAGCCACCGCTATT pLKO_005 3328 CDS 100% 10.800 7.560 N Nbr1 n/a
7 TRCN0000123385 GCTAACATTAAGCAAGGAAAT pLKO.1 705 CDS 100% 10.800 7.560 N Nbr1 n/a
8 TRCN0000123387 CCTACAACATTTGTGAAGATT pLKO.1 1204 CDS 100% 5.625 3.938 N Nbr1 n/a
9 TRCN0000123384 CCTTGAATGTTTCCAAGAATT pLKO.1 3741 3UTR 100% 0.000 0.000 N Nbr1 n/a
10 TRCN0000123160 GCAGCATTTGTGGATGAGAAT pLKO.1 1614 CDS 100% 4.950 2.970 N NBR1 n/a
11 TRCN0000365516 GCCTATGCCCATCCTACAATA pLKO_005 1192 CDS 100% 13.200 9.240 N NBR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.