Transcript: Mouse NM_001252467.1

Mus musculus RAN binding protein 3 (Ranbp3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ranbp3 (71810)
Length:
2352
CDS:
166..1482

Additional Resources:

NCBI RefSeq record:
NM_001252467.1
NBCI Gene record:
Ranbp3 (71810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194571 CAGATGGATAAGGCCAGTGAA pLKO.1 1168 CDS 100% 4.950 6.930 N Ranbp3 n/a
2 TRCN0000174754 GAGAGACAGAGTGAAGTTAAT pLKO.1 579 CDS 100% 13.200 9.240 N Ranbp3 n/a
3 TRCN0000352549 GAGAGACAGAGTGAAGTTAAT pLKO_005 579 CDS 100% 13.200 9.240 N Ranbp3 n/a
4 TRCN0000341226 GGACTCAGACCTCATCATATT pLKO_005 1638 3UTR 100% 13.200 9.240 N Ranbp3 n/a
5 TRCN0000173856 GCTGACAACTCCACCAAGTTT pLKO.1 721 CDS 100% 5.625 3.938 N Ranbp3 n/a
6 TRCN0000341158 GCTGACAACTCCACCAAGTTT pLKO_005 721 CDS 100% 5.625 3.938 N Ranbp3 n/a
7 TRCN0000194506 GCTCAGCATTCTGTTGAGTAA pLKO.1 1771 3UTR 100% 4.950 3.465 N Ranbp3 n/a
8 TRCN0000173419 GAAGATTCTGACCATGAGGAT pLKO.1 277 CDS 100% 2.640 1.848 N Ranbp3 n/a
9 TRCN0000341157 GAAGATTCTGACCATGAGGAT pLKO_005 277 CDS 100% 2.640 1.848 N Ranbp3 n/a
10 TRCN0000173692 CCAAAGCTGAATGAAGCCAAT pLKO.1 781 CDS 100% 4.050 2.430 N Ranbp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.