Transcript: Mouse NM_001252488.1

Mus musculus cation channel, sperm associated 3 (Catsper3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Catsper3 (76856)
Length:
1199
CDS:
84..1118

Additional Resources:

NCBI RefSeq record:
NM_001252488.1
NBCI Gene record:
Catsper3 (76856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069827 CCAGTCTCTACGAATCCTCAA pLKO.1 374 CDS 100% 4.050 5.670 N Catsper3 n/a
2 TRCN0000069826 GCAAGATTAAGAGGAAGGATA pLKO.1 172 CDS 100% 4.950 3.465 N Catsper3 n/a
3 TRCN0000069824 CCTTGCGATTATGGAGGAGAA pLKO.1 791 CDS 100% 4.050 2.835 N Catsper3 n/a
4 TRCN0000069825 CCAAGATGTTATTGTCAGCAA pLKO.1 1001 CDS 100% 2.640 1.848 N Catsper3 n/a
5 TRCN0000069823 GCTCACTGTTTGCTACAGCAT pLKO.1 127 CDS 100% 2.640 1.848 N Catsper3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.