Transcript: Mouse NM_001252492.1

Mus musculus oxysterol binding protein-like 1A (Osbpl1a), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Osbpl1a (64291)
Length:
3072
CDS:
866..2179

Additional Resources:

NCBI RefSeq record:
NM_001252492.1
NBCI Gene record:
Osbpl1a (64291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105073 GCAGCGGCTAACTGAATACAT pLKO.1 1057 CDS 100% 5.625 7.875 N Osbpl1a n/a
2 TRCN0000316757 GCAGCGGCTAACTGAATACAT pLKO_005 1057 CDS 100% 5.625 7.875 N Osbpl1a n/a
3 TRCN0000105070 TCAAGGTGTTTGCTAATCTAA pLKO.1 2192 3UTR 100% 5.625 3.938 N Osbpl1a n/a
4 TRCN0000316756 TCAAGGTGTTTGCTAATCTAA pLKO_005 2192 3UTR 100% 5.625 3.938 N Osbpl1a n/a
5 TRCN0000105071 CGAAGCATACACATGGACAAA pLKO.1 1426 CDS 100% 4.950 3.465 N Osbpl1a n/a
6 TRCN0000316755 CGAAGCATACACATGGACAAA pLKO_005 1426 CDS 100% 4.950 3.465 N Osbpl1a n/a
7 TRCN0000105074 CCAGTGATATTTAATGAGCCT pLKO.1 1025 CDS 100% 0.660 0.462 N Osbpl1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.