Transcript: Mouse NM_001252513.1

Mus musculus lipase, member I (Lipi), mRNA.

Source:
NCBI, updated 2015-07-31
Taxon:
Mus musculus (mouse)
Gene:
Lipi (320355)
Length:
2082
CDS:
112..1542

Additional Resources:

NCBI RefSeq record:
NM_001252513.1
NBCI Gene record:
Lipi (320355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251052 CCACCAATTTGTAAGTATAAT pLKO_005 1456 CDS 100% 15.000 21.000 N Lipi n/a
2 TRCN0000251050 ATTCTTGTTCAGTTCGTAAAT pLKO_005 1315 CDS 100% 13.200 18.480 N Lipi n/a
3 TRCN0000215555 GATTCTTGTTCAGTTCGTAAA pLKO.1 1314 CDS 100% 10.800 15.120 N Lipi n/a
4 TRCN0000251049 TTGTGAGCATTTCGCGCATTT pLKO_005 1340 CDS 100% 10.800 15.120 N Lipi n/a
5 TRCN0000191194 CCAGGTATATCTACCTTAATT pLKO.1 1642 3UTR 100% 1.500 2.100 N Lipi n/a
6 TRCN0000258129 TGGAATACTCAACACTCTATG pLKO_005 1256 CDS 100% 10.800 8.640 N Lipi n/a
7 TRCN0000251051 ACATCTGCTGCTTAGCTTAAT pLKO_005 1786 3UTR 100% 13.200 9.240 N Lipi n/a
8 TRCN0000216614 GAAGAGCAAGCCATTTGATAA pLKO.1 1278 CDS 100% 13.200 9.240 N Lipi n/a
9 TRCN0000200686 GACCACCAATTTGTAAGTATA pLKO.1 1454 CDS 100% 13.200 9.240 N Lipi n/a
10 TRCN0000201764 GCCTGCTTCCTAAGTGAATTT pLKO.1 1750 3UTR 100% 13.200 7.920 N Lipi n/a
11 TRCN0000216198 CATACTTTCAGTCCACAAATC pLKO.1 1367 CDS 100% 10.800 6.480 N Lipi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.