Transcript: Mouse NM_001252555.1

Mus musculus glutathione transferase zeta 1 (maleylacetoacetate isomerase) (Gstz1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Gstz1 (14874)
Length:
1986
CDS:
592..1077

Additional Resources:

NCBI RefSeq record:
NM_001252555.1
NBCI Gene record:
Gstz1 (14874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103082 AGGTTATTACTTCCGGCTTTA pLKO.1 824 CDS 100% 10.800 15.120 N Gstz1 n/a
2 TRCN0000326474 AGGTTATTACTTCCGGCTTTA pLKO_005 824 CDS 100% 10.800 15.120 N Gstz1 n/a
3 TRCN0000103080 CCCAGAAATGAATGCATTATA pLKO.1 1446 3UTR 100% 15.000 10.500 N Gstz1 n/a
4 TRCN0000326475 CCCAGAAATGAATGCATTATA pLKO_005 1446 3UTR 100% 15.000 10.500 N Gstz1 n/a
5 TRCN0000103084 AGTGCCCATCAACCTCATAAA pLKO.1 525 5UTR 100% 13.200 9.240 N Gstz1 n/a
6 TRCN0000326476 AGTGCCCATCAACCTCATAAA pLKO_005 525 5UTR 100% 13.200 9.240 N Gstz1 n/a
7 TRCN0000103083 CCCTACCATCAGTCACATCAA pLKO.1 975 CDS 100% 4.950 3.465 N Gstz1 n/a
8 TRCN0000326403 CCCTACCATCAGTCACATCAA pLKO_005 975 CDS 100% 4.950 3.465 N Gstz1 n/a
9 TRCN0000103081 GAAAGGTTCAAGGTGGATCTA pLKO.1 946 CDS 100% 4.950 3.465 N Gstz1 n/a
10 TRCN0000326477 GAAAGGTTCAAGGTGGATCTA pLKO_005 946 CDS 100% 4.950 3.465 N Gstz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252555.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.