Transcript: Mouse NM_001252562.1

Mus musculus RAD51 paralog B (Rad51b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rad51b (19363)
Length:
1757
CDS:
56..832

Additional Resources:

NCBI RefSeq record:
NM_001252562.1
NBCI Gene record:
Rad51b (19363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071265 GCTTCTTCATACAGTAAGCAA pLKO.1 208 CDS 100% 3.000 2.400 N Rad51b n/a
2 TRCN0000071266 GCTGAGAGACTGGTTGAGATT pLKO.1 500 CDS 100% 4.950 3.465 N Rad51b n/a
3 TRCN0000071264 CCGTTTAAGCAGATACCAGAT pLKO.1 106 CDS 100% 4.050 2.835 N Rad51b n/a
4 TRCN0000071267 GCTTGTGATTGTTGACTCCAT pLKO.1 670 CDS 100% 2.640 1.848 N Rad51b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.