Transcript: Human NM_001252677.1

Homo sapiens acyl-CoA synthetase short chain family member 1 (ACSS1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSS1 (84532)
Length:
2448
CDS:
81..1808

Additional Resources:

NCBI RefSeq record:
NM_001252677.1
NBCI Gene record:
ACSS1 (84532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423168 GGCCTACCCAGGCTATTACTT pLKO_005 1649 CDS 100% 5.625 7.875 N ACSS1 n/a
2 TRCN0000436733 GACACAGCTACGTGGTGTATG pLKO_005 1105 CDS 100% 10.800 8.640 N ACSS1 n/a
3 TRCN0000425235 ATCACCTACAGGGAACTACTG pLKO_005 501 CDS 100% 4.050 3.240 N ACSS1 n/a
4 TRCN0000045379 CCAGTTAAATGTCTCTGTCAA pLKO.1 398 CDS 100% 4.950 3.465 N ACSS1 n/a
5 TRCN0000424197 GGTTGAAGATCAATCAGTTCT pLKO_005 1213 CDS 100% 4.950 3.465 N ACSS1 n/a
6 TRCN0000045381 CAAGGTGGTTATCACCTTCAA pLKO.1 719 CDS 100% 0.495 0.347 N ACSS1 n/a
7 TRCN0000045380 CTGTTGCTGAAATACGGTGAT pLKO.1 1257 CDS 100% 4.050 2.430 N ACSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.