Transcript: Mouse NM_001253700.1

Mus musculus elongator acetyltransferase complex subunit 5 (Elp5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Elp5 (54351)
Length:
969
CDS:
247..753

Additional Resources:

NCBI RefSeq record:
NM_001253700.1
NBCI Gene record:
Elp5 (54351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201055 CCAGATGATGACCTAGATATT pLKO.1 730 CDS 100% 13.200 9.240 N Elp5 n/a
2 TRCN0000190871 CTTGTCCCTTGTCCTTTGTTA pLKO.1 814 3UTR 100% 5.625 3.938 N Elp5 n/a
3 TRCN0000192282 CCTTGTCCTTTGTTACTTTGT pLKO.1 820 3UTR 100% 4.950 3.465 N Elp5 n/a
4 TRCN0000191021 CTTATCAAGAAATCTGCACTT pLKO.1 156 5UTR 100% 4.050 2.835 N Elp5 n/a
5 TRCN0000127506 CCACATCTTCTATGAGCCAGA pLKO.1 681 CDS 100% 2.160 1.512 N ELP5 n/a
6 TRCN0000343049 CCACATCTTCTATGAGCCAGA pLKO_005 681 CDS 100% 2.160 1.512 N ELP5 n/a
7 TRCN0000216725 CTTCTATGAGCCAGATGCTTT pLKO.1 687 CDS 100% 4.950 2.970 N Elp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.