Transcript: Mouse NM_001253714.1

Mus musculus methionine sulfoxide reductase A (Msra), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Msra (110265)
Length:
1398
CDS:
182..814

Additional Resources:

NCBI RefSeq record:
NM_001253714.1
NBCI Gene record:
Msra (110265)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042096 CAAGTGTTCTACTATGCCGAA pLKO.1 701 CDS 100% 2.160 3.024 N Msra n/a
2 TRCN0000334725 CAAGTGTTCTACTATGCCGAA pLKO_005 701 CDS 100% 2.160 3.024 N Msra n/a
3 TRCN0000042094 CGAAGACTACCACCAGCAATA pLKO.1 718 CDS 100% 10.800 7.560 N Msra n/a
4 TRCN0000042097 CGACTCAGCTTCGAAAGTCAT pLKO.1 247 CDS 100% 4.950 3.465 N Msra n/a
5 TRCN0000334646 CGACTCAGCTTCGAAAGTCAT pLKO_005 247 CDS 100% 4.950 3.465 N Msra n/a
6 TRCN0000042095 CTGGGTCTTGAAAGGAGTGTA pLKO.1 352 CDS 100% 4.950 3.465 N Msra n/a
7 TRCN0000334723 CTGGGTCTTGAAAGGAGTGTA pLKO_005 352 CDS 100% 4.950 3.465 N Msra n/a
8 TRCN0000042093 GCCAAGGCAATGACTTTGGTA pLKO.1 549 CDS 100% 3.000 2.100 N Msra n/a
9 TRCN0000334648 GCCAAGGCAATGACTTTGGTA pLKO_005 549 CDS 100% 3.000 2.100 N Msra n/a
10 TRCN0000046457 TGGGTCTTGAAAGGAGTGTAT pLKO.1 353 CDS 100% 4.950 3.465 N MSRA n/a
11 TRCN0000286327 TGGGTCTTGAAAGGAGTGTAT pLKO_005 353 CDS 100% 4.950 3.465 N MSRA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253714.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.