Transcript: Mouse NM_001253743.1

Mus musculus Fc receptor, IgE, low affinity II, alpha polypeptide (Fcer2a), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fcer2a (14128)
Length:
2160
CDS:
173..1087

Additional Resources:

NCBI RefSeq record:
NM_001253743.1
NBCI Gene record:
Fcer2a (14128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067637 CTCAATATGGAGGGAGAGTTT pLKO.1 836 CDS 100% 4.950 3.960 N Fcer2a n/a
2 TRCN0000067634 CCAACAGAAGTGCTACTATTT pLKO.1 670 CDS 100% 13.200 9.240 N Fcer2a n/a
3 TRCN0000067636 CTGTGGATAGAGATACTGATT pLKO.1 602 CDS 100% 4.950 3.465 N Fcer2a n/a
4 TRCN0000067635 GCAATTCAGAATGTCTCTCAT pLKO.1 275 CDS 100% 4.950 3.465 N Fcer2a n/a
5 TRCN0000067633 CCAAGGTCTATTCCCTTATTT pLKO.1 1713 3UTR 100% 15.000 7.500 Y Fcer2a n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 1984 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.