Transcript: Mouse NM_001253805.1

Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ywhaz (22631)
Length:
3604
CDS:
406..1143

Additional Resources:

NCBI RefSeq record:
NM_001253805.1
NBCI Gene record:
Ywhaz (22631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071054 CGTCTCAAGTATTGAGCAGAA pLKO.1 588 CDS 100% 4.050 3.240 N Ywhaz n/a
2 TRCN0000316453 CGTCTCAAGTATTGAGCAGAA pLKO_005 588 CDS 100% 4.050 3.240 N Ywhaz n/a
3 TRCN0000071053 CCATTGCTGAACTTGATACAT pLKO.1 1001 CDS 100% 5.625 3.938 N Ywhaz n/a
4 TRCN0000316383 CCATTGCTGAACTTGATACAT pLKO_005 1001 CDS 100% 5.625 3.938 N Ywhaz n/a
5 TRCN0000071057 GCAACCAGAAAGCAAAGTCTT pLKO.1 735 CDS 100% 4.950 3.465 N Ywhaz n/a
6 TRCN0000316456 GCAACCAGAAAGCAAAGTCTT pLKO_005 735 CDS 100% 4.950 3.465 N Ywhaz n/a
7 TRCN0000071055 GCAACGATGTACTGTCTCTTT pLKO.1 686 CDS 100% 4.950 3.465 N Ywhaz n/a
8 TRCN0000316455 GCAACGATGTACTGTCTCTTT pLKO_005 686 CDS 100% 4.950 3.465 N Ywhaz n/a
9 TRCN0000071056 GCTGTCGAATGAGGAGAGAAA pLKO.1 510 CDS 100% 4.950 3.465 N Ywhaz n/a
10 TRCN0000316385 GCTGTCGAATGAGGAGAGAAA pLKO_005 510 CDS 100% 4.950 3.465 N Ywhaz n/a
11 TRCN0000029406 GCTCGAGAATACAGAGAGAAA pLKO.1 640 CDS 100% 0.000 0.000 N YWHAZ n/a
12 TRCN0000292169 GCTCGAGAATACAGAGAGAAA pLKO_005 640 CDS 100% 0.000 0.000 N YWHAZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.