Transcript: Human NM_001253845.2

Homo sapiens adrenomedullin 2 (ADM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ADM2 (79924)
Length:
4213
CDS:
233..679

Additional Resources:

NCBI RefSeq record:
NM_001253845.2
NBCI Gene record:
ADM2 (79924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158429 CGAACACTGAGCATTTAATTT pLKO.1 1751 3UTR 100% 15.000 10.500 N ADM2 n/a
2 TRCN0000159169 GCGAACACTGAGCATTTAATT pLKO.1 1750 3UTR 100% 15.000 10.500 N ADM2 n/a
3 TRCN0000162628 GAGCCTAAACACCCTGAAATT pLKO.1 867 3UTR 100% 13.200 9.240 N ADM2 n/a
4 TRCN0000424609 ACGGCTTTGCACACGTAAACC pLKO_005 812 3UTR 100% 4.950 3.465 N ADM2 n/a
5 TRCN0000166783 CCCAAGTGACAGCAAGAACAA pLKO.1 1594 3UTR 100% 4.950 3.465 N ADM2 n/a
6 TRCN0000424671 ACCTGTGGTCTGGAAGCTTCA pLKO_005 400 CDS 100% 4.050 2.835 N ADM2 n/a
7 TRCN0000421014 CACCAGATGCTAAGCGCTTCA pLKO_005 930 3UTR 100% 4.050 2.835 N ADM2 n/a
8 TRCN0000416296 AGAATCTCAGCCACCGCCTGT pLKO_005 585 CDS 100% 0.720 0.504 N ADM2 n/a
9 TRCN0000166700 CAACAATACCTGCACGGCTTT pLKO.1 799 3UTR 100% 4.050 2.430 N ADM2 n/a
10 TRCN0000159406 GTTAGCAAGAATCCTCTAAAT pLKO.1 3936 3UTR 100% 13.200 6.600 Y ADM2 n/a
11 TRCN0000166612 CCTTCACACCTTCCTCTGAAT pLKO.1 3146 3UTR 100% 4.950 2.475 Y ADM2 n/a
12 TRCN0000165477 GAAGCCCAGAACTCTGATCTT pLKO.1 3583 3UTR 100% 4.950 2.475 Y ADM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.