Transcript: Human NM_001254718.1

Homo sapiens myosin binding protein C, slow type (MYBPC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
MYBPC1 (4604)
Length:
3930
CDS:
141..3662

Additional Resources:

NCBI RefSeq record:
NM_001254718.1
NBCI Gene record:
MYBPC1 (4604)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001254718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149673 GCCGGATAAGAACAGAATCTT pLKO.1 1852 CDS 100% 5.625 7.875 N MYBPC1 n/a
2 TRCN0000148310 CGAGACTTACACTCAAGCAAT pLKO.1 3677 3UTR 100% 4.950 6.930 N MYBPC1 n/a
3 TRCN0000149248 GATTCGTATCTGCGAGACTTA pLKO.1 3665 3UTR 100% 4.950 6.930 N MYBPC1 n/a
4 TRCN0000148474 CCACAAGTTAGTGATAGCCAA pLKO.1 1595 CDS 100% 2.640 2.112 N MYBPC1 n/a
5 TRCN0000148214 GCAAGTCAAAGTGGACAAATT pLKO.1 2873 CDS 100% 13.200 9.240 N MYBPC1 n/a
6 TRCN0000146264 CCAGTGTATGAAGACTTTGAT pLKO.1 3246 CDS 100% 5.625 3.938 N MYBPC1 n/a
7 TRCN0000146297 CTGCTTTGAAATCTGGTTGAA pLKO.1 3746 3UTR 100% 4.950 3.465 N MYBPC1 n/a
8 TRCN0000149318 GCTGGAAGATACAACTGCTTA pLKO.1 1181 CDS 100% 4.950 3.465 N MYBPC1 n/a
9 TRCN0000147071 CCGGATAAGAACAGAATCTTA pLKO.1 1853 CDS 100% 0.563 0.394 N MYBPC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.