Transcript: Mouse NM_001254744.1

Mus musculus RIKEN cDNA E030030I06 gene (E030030I06Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2016-07-26
Taxon:
Mus musculus (mouse)
Gene:
E030030I06Rik (319887)
Length:
2081
CDS:
259..999

Additional Resources:

NCBI RefSeq record:
NM_001254744.1
NBCI Gene record:
E030030I06Rik (319887)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001254744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360961 TCATTGCCTAGCCTGATTATA pLKO_005 1259 3UTR 100% 15.000 21.000 N E030030I06Rik n/a
2 TRCN0000023013 CTACGTGGTCAGAGCATTCAT pLKO.1 771 CDS 100% 5.625 7.875 N E030030I06Rik n/a
3 TRCN0000023012 CCGATCAGAGTACGAGTGCTT pLKO.1 599 CDS 100% 2.640 3.696 N E030030I06Rik n/a
4 TRCN0000360907 GAGCATTCATATTGGTTAATT pLKO_005 782 CDS 100% 15.000 10.500 N E030030I06Rik n/a
5 TRCN0000023009 CAGAGCATTCATATTGGTTAA pLKO.1 780 CDS 100% 10.800 7.560 N E030030I06Rik n/a
6 TRCN0000378370 TGTGGGCAGACTACGTAATCG pLKO_005 354 CDS 100% 4.950 2.970 N E030030I06Rik n/a
7 TRCN0000368004 ATTGGTTATGCATGGGTTATG pLKO_005 1483 3UTR 100% 10.800 5.400 Y E030030I06Rik n/a
8 TRCN0000023011 GCAGAGATTGTGGGCAGACTA pLKO.1 346 CDS 100% 4.950 2.475 Y E030030I06Rik n/a
9 TRCN0000023010 CCTCATTTGCATGTTCCTCAT pLKO.1 975 CDS 100% 4.050 2.025 Y E030030I06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254744.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.