Transcript: Mouse NM_001254951.1

Mus musculus zinc finger protein 850 (Zfp850), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Zfp850 (100043772)
Length:
6546
CDS:
236..2305

Additional Resources:

NCBI RefSeq record:
NM_001254951.1
NBCI Gene record:
Zfp850 (100043772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001254951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225820 GCTACAGGTCTGTTGGCTTTC pLKO_005 5883 3UTR 100% 6.000 4.200 N Zfp850 n/a
2 TRCN0000225821 CAACTGCCACCCAAAGTTCTT pLKO_005 5934 3UTR 100% 4.950 3.465 N Zfp850 n/a
3 TRCN0000225823 CGAATGCATGGATGGATTGTG pLKO_005 6084 3UTR 100% 4.950 3.465 N Zfp850 n/a
4 TRCN0000225822 GAAGAGGGCTCTCGAATGCAT pLKO_005 6072 3UTR 100% 3.000 1.800 N Zfp850 n/a
5 TRCN0000234273 ATGCTACTCAGAAGGTCTTAT pLKO_005 330 CDS 100% 13.200 6.600 Y Gm7452 n/a
6 TRCN0000147730 GAATGTAAGGATTGTGGGAAA pLKO.1 836 CDS 100% 4.050 2.430 N ZNF700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001254951.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.