Transcript: Mouse NM_001255994.1

Mus musculus U box domain containing 5 (Ubox5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ubox5 (140629)
Length:
3753
CDS:
308..1927

Additional Resources:

NCBI RefSeq record:
NM_001255994.1
NBCI Gene record:
Ubox5 (140629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001255994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339891 TCATTAGACCTCCAATCTATG pLKO_005 444 CDS 100% 10.800 8.640 N Ubox5 n/a
2 TRCN0000339962 AGGCAACAACAGGATAATAAA pLKO_005 2078 3UTR 100% 15.000 10.500 N Ubox5 n/a
3 TRCN0000195805 CTCTGCCACAAGCCCTTTATT pLKO.1 1456 CDS 100% 15.000 10.500 N Ubox5 n/a
4 TRCN0000339887 CTCTGCCACAAGCCCTTTATT pLKO_005 1456 CDS 100% 15.000 10.500 N Ubox5 n/a
5 TRCN0000339888 TGGAAATCTGTAGGGTTAATA pLKO_005 489 CDS 100% 15.000 10.500 N Ubox5 n/a
6 TRCN0000339961 CCTACTCCAGCACTCTATTTC pLKO_005 1300 CDS 100% 13.200 9.240 N Ubox5 n/a
7 TRCN0000180023 CCTCCAATCTATGTGACAGTT pLKO.1 452 CDS 100% 4.950 3.465 N Ubox5 n/a
8 TRCN0000178893 CCCTTTAATGTGGAAATCTGT pLKO.1 479 CDS 100% 3.000 2.100 N Ubox5 n/a
9 TRCN0000183955 CGGATAAGCAAGGGTTCAGAT pLKO.1 2457 3UTR 100% 4.950 2.970 N Ubox5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001255994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.