Transcript: Mouse NM_001256019.1

Mus musculus bone morphogenetic protein 8a (Bmp8a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Bmp8a (12163)
Length:
2405
CDS:
545..1783

Additional Resources:

NCBI RefSeq record:
NM_001256019.1
NBCI Gene record:
Bmp8a (12163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001256019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065758 CCTGCGTAAACACCGTAACAT pLKO.1 1735 CDS 100% 5.625 7.875 N Bmp8a n/a
2 TRCN0000065761 ACAGCCTTTCATGGTAACCTT pLKO.1 1267 CDS 100% 3.000 2.400 N Bmp8a n/a
3 TRCN0000065759 CACCTGATGAAGCCAGATGTT pLKO.1 1637 CDS 100% 4.950 3.465 N Bmp8a n/a
4 TRCN0000065760 ACACCGTAACATGGTGGTCAA pLKO.1 1744 CDS 100% 4.050 2.835 N Bmp8a n/a
5 TRCN0000065762 GCCGCGACATGCAGCGTGAAA pLKO.1 663 CDS 100% 0.000 0.000 N Bmp8a n/a
6 TRCN0000058276 AGGGAGTCTGACTTGTTCTTT pLKO.1 1058 CDS 100% 5.625 2.813 Y BMP8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.