Transcript: Mouse NM_001256057.1

Mus musculus keratin associated protein 16-1 (Krtap16-1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Krtap16-1 (100504183)
Length:
1891
CDS:
18..1526

Additional Resources:

NCBI RefSeq record:
NM_001256057.1
NBCI Gene record:
Krtap16-1 (100504183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001256057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090692 CAACGATAAGTGTGATAGCAA pLKO.1 1343 CDS 100% 3.000 4.200 N LOC435287 n/a
2 TRCN0000090691 CTCTGGTATGTGAGCCTGTTT pLKO.1 796 CDS 100% 4.950 3.960 N LOC435287 n/a
3 TRCN0000090689 CCTGCTACATAGTCAAACGAT pLKO.1 979 CDS 100% 3.000 2.400 N LOC435287 n/a
4 TRCN0000090688 GCACTGATTCTGACAACGATA pLKO.1 1330 CDS 100% 4.950 3.465 N LOC435287 n/a
5 TRCN0000090690 CTACCATTTGTGAGCCCTCTT pLKO.1 244 CDS 100% 4.050 2.835 N LOC435287 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256057.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.