Transcript: Mouse NM_001256059.1

Mus musculus coiled-coil domain containing 149 (Ccdc149), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Ccdc149 (100503884)
Length:
3317
CDS:
146..1720

Additional Resources:

NCBI RefSeq record:
NM_001256059.1
NBCI Gene record:
Ccdc149 (100503884)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001256059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184721 CCCATTCATCGTAAACCCTGT pLKO.1 2688 3UTR 100% 2.160 3.024 N Ccdc149 n/a
2 TRCN0000183251 GAGAAATGCATTCCCATTCAT pLKO.1 2676 3UTR 100% 5.625 3.938 N Ccdc149 n/a
3 TRCN0000183739 CAATGTCCTGTTTATCTCTAT pLKO.1 2756 3UTR 100% 4.950 3.465 N Ccdc149 n/a
4 TRCN0000136802 CGAGAGCTGATTGATGGAGAT pLKO.1 344 CDS 100% 4.050 2.835 N CCDC149 n/a
5 TRCN0000183480 GCTCAATGTATACATCCAGAT pLKO.1 3173 3UTR 100% 4.050 2.430 N Ccdc149 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.