Transcript: Human NM_001256267.1

Homo sapiens myopalladin (MYPN), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MYPN (84665)
Length:
5725
CDS:
188..4150

Additional Resources:

NCBI RefSeq record:
NM_001256267.1
NBCI Gene record:
MYPN (84665)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419952 ACCATCACCTTTCATCGATTA pLKO_005 4586 3UTR 100% 10.800 15.120 N MYPN n/a
2 TRCN0000073455 GCCGACTTCATTGAAGAGCTA pLKO.1 650 CDS 100% 2.640 3.696 N MYPN n/a
3 TRCN0000073454 CCAGTCACATTCACCTGCAAA pLKO.1 3068 CDS 100% 4.950 6.435 N MYPN n/a
4 TRCN0000416012 GATGAAACACTCACCTAATTT pLKO_005 499 CDS 100% 15.000 10.500 N MYPN n/a
5 TRCN0000423768 TGATGAATGAAATAGAGTTTC pLKO_005 2922 CDS 100% 10.800 7.560 N MYPN n/a
6 TRCN0000073456 CGACCCTAACAAGGAAGAGAT pLKO.1 1291 CDS 100% 4.950 3.465 N MYPN n/a
7 TRCN0000073453 GCCACATAATAAGGTGTCAAA pLKO.1 4729 3UTR 100% 4.950 3.465 N MYPN n/a
8 TRCN0000073457 CGATGGTGTATTCATGCTCTT pLKO.1 4098 CDS 100% 4.050 2.835 N MYPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.