Transcript: Human NM_001256314.1

Homo sapiens solute carrier family 5 member 1 (SLC5A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC5A1 (6523)
Length:
4779
CDS:
350..1963

Additional Resources:

NCBI RefSeq record:
NM_001256314.1
NBCI Gene record:
SLC5A1 (6523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426548 AGGAGAGCCTATGACCTATTT pLKO_005 1775 CDS 100% 13.200 18.480 N SLC5A1 n/a
2 TRCN0000431844 ACAGCAAAGAGGAGCGTATTG pLKO_005 1662 CDS 100% 10.800 15.120 N SLC5A1 n/a
3 TRCN0000422685 GGACAGTGTTGAACGTCAATG pLKO_005 1893 CDS 100% 10.800 15.120 N SLC5A1 n/a
4 TRCN0000043590 GCCATTATCCTCTTCGCCATT pLKO.1 1556 CDS 100% 4.050 2.835 N SLC5A1 n/a
5 TRCN0000043591 CCATCTTTCTCTTATTGGCAA pLKO.1 507 CDS 100% 2.640 1.848 N SLC5A1 n/a
6 TRCN0000043588 CGCCATTTCTTTCATCACCAT pLKO.1 1570 CDS 100% 2.640 1.848 N SLC5A1 n/a
7 TRCN0000043589 CCCTTCAGAATGTGAGAAATA pLKO.1 1009 CDS 100% 13.200 7.920 N SLC5A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256314.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.