Transcript: Human NM_001256378.1

Homo sapiens minichromosome maintenance complex binding protein (MCMBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
MCMBP (79892)
Length:
4292
CDS:
300..2222

Additional Resources:

NCBI RefSeq record:
NM_001256378.1
NBCI Gene record:
MCMBP (79892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263792 GAACACTTGTATCGAATTATT pLKO_005 1503 CDS 100% 15.000 21.000 N MCMBP n/a
2 TRCN0000263794 TTGCCAAGTAATCCGAATAAA pLKO_005 2904 3UTR 100% 15.000 21.000 N MCMBP n/a
3 TRCN0000263791 GTCGCCACAAGAGGAGTTATG pLKO_005 784 CDS 100% 10.800 15.120 N MCMBP n/a
4 TRCN0000263793 TGCAACACATCAACCCATTAT pLKO_005 1243 CDS 100% 13.200 10.560 N MCMBP n/a
5 TRCN0000281628 TGGCTGCTGAATACCTTATAT pLKO_005 1384 CDS 100% 15.000 10.500 N MCMBP n/a
6 TRCN0000172345 CCCAGCAATACTTCCCTTGTA pLKO.1 1644 CDS 100% 4.950 3.465 N MCMBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256378.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.