Transcript: Human NM_001256477.1

Homo sapiens cytidine/uridine monophosphate kinase 2 (CMPK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
CMPK2 (129607)
Length:
2176
CDS:
124..1353

Additional Resources:

NCBI RefSeq record:
NM_001256477.1
NBCI Gene record:
CMPK2 (129607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145007 AGGTAATATTATCTTACCCG pXPR_003 TGG 790 64% 2 1.2039 CMPK2 CMPK2 75805
2 BRDN0001144952 CCGGGCTTCAGGAATAAAGG pXPR_003 AGG 685 56% 2 0.9068 CMPK2 CMPK2 75804
3 BRDN0001147027 GAGGCACCACGCCCGCACTT pXPR_003 GGG 479 39% 1 0.4593 CMPK2 CMPK2 75806
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149686 GTCAGTGGCAGATTCACTTAA pLKO.1 933 CDS 100% 13.200 18.480 N CMPK2 n/a
2 TRCN0000437006 TTGAGGCCAACAGTGTGTTTC pLKO_005 1322 CDS 100% 10.800 15.120 N CMPK2 n/a
3 TRCN0000429127 ATGAACCAACTATCATTAGAA pLKO_005 1013 CDS 100% 5.625 7.875 N CMPK2 n/a
4 TRCN0000435942 GCCAAATCTCCTGTGATTGTA pLKO_005 1090 CDS 100% 5.625 4.500 N CMPK2 n/a
5 TRCN0000148610 CAGATCCAGAAAGGAAAGTTC pLKO.1 859 CDS 100% 4.950 3.465 N CMPK2 n/a
6 TRCN0000436678 GGACTGGATGCCACGGGTAAA pLKO_005 898 CDS 100% 3.600 2.520 N CMPK2 n/a
7 TRCN0000148334 CAGAAAGGAAAGTTCCAGGTT pLKO.1 865 CDS 100% 2.640 1.848 N CMPK2 n/a
8 TRCN0000149263 GATCCAGAAAGGAAAGTTCCA pLKO.1 861 CDS 100% 2.640 1.848 N CMPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.