Transcript: Human NM_001256668.1

Homo sapiens family with sequence similarity 193 member A (FAM193A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
FAM193A (8603)
Length:
4835
CDS:
352..3987

Additional Resources:

NCBI RefSeq record:
NM_001256668.1
NBCI Gene record:
FAM193A (8603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263596 GTCTATCAACTGGTCCAATTT pLKO_005 4065 3UTR 100% 13.200 18.480 N FAM193A n/a
2 TRCN0000282706 GTGTACACGTTGCGCTGTTTG pLKO_005 4585 3UTR 100% 10.800 15.120 N FAM193A n/a
3 TRCN0000168139 CCATATTTATCCGAGCTGTTT pLKO.1 1878 CDS 100% 4.950 6.930 N FAM193A n/a
4 TRCN0000263594 CAGCCAAATTTGCTGATATTT pLKO_005 1256 CDS 100% 15.000 10.500 N FAM193A n/a
5 TRCN0000252761 CATCTCTTCAAGACCATATTT pLKO_005 1865 CDS 100% 15.000 10.500 N Fam193a n/a
6 TRCN0000263595 CATCTCTTCAAGACCATATTT pLKO_005 1865 CDS 100% 15.000 10.500 N FAM193A n/a
7 TRCN0000282705 ACATCATGCAGCACCATAAAG pLKO_005 3455 CDS 100% 13.200 9.240 N FAM193A n/a
8 TRCN0000172450 CCTTCAGTAGGTGACGTGTTT pLKO.1 2272 CDS 100% 4.950 3.465 N FAM193A n/a
9 TRCN0000172572 GCCACTTCTTCAGAGCAACTT pLKO.1 597 CDS 100% 4.950 3.465 N FAM193A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.