Transcript: Human NM_001256752.2

Homo sapiens peroxisomal biogenesis factor 5 like (PEX5L), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PEX5L (51555)
Length:
8984
CDS:
339..2114

Additional Resources:

NCBI RefSeq record:
NM_001256752.2
NBCI Gene record:
PEX5L (51555)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159709 GCTGTGAGTTATACTAACACT pLKO.1 1434 CDS 100% 3.000 4.200 N PEX5L n/a
2 TRCN0000159675 GCTGTTCCCAATCTAAACTTT pLKO.1 2707 3UTR 100% 5.625 4.500 N PEX5L n/a
3 TRCN0000160133 CGATGACATAAGGCGTAAATA pLKO.1 2923 3UTR 100% 15.000 10.500 N PEX5L n/a
4 TRCN0000160069 CCTTAGATCTAGACATTCAAA pLKO.1 727 CDS 100% 5.625 3.938 N PEX5L n/a
5 TRCN0000162040 CCTAGGAATAAGCTGCATCAA pLKO.1 1874 CDS 100% 4.950 3.465 N PEX5L n/a
6 TRCN0000163454 GCAGTGATGAAGACCTCGAAA pLKO.1 391 CDS 100% 4.950 3.465 N PEX5L n/a
7 TRCN0000159639 GCGTAAATATGGCAAACAGAT pLKO.1 2935 3UTR 100% 4.950 3.465 N PEX5L n/a
8 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 4744 3UTR 100% 4.950 2.475 Y DENND6A n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4810 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.