Transcript: Human NM_001256896.1

Homo sapiens docking protein 7 (DOK7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DOK7 (285489)
Length:
2281
CDS:
699..1283

Additional Resources:

NCBI RefSeq record:
NM_001256896.1
NBCI Gene record:
DOK7 (285489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243959 CTGTGGAGGACTCAAGGTAAA pLKO_005 1250 CDS 100% 10.800 14.040 N DOK7 n/a
2 TRCN0000243961 GGCAGTCACACCACCTGTTAA pLKO_005 1705 3UTR 100% 13.200 9.240 N DOK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16151 pDONR223 0% 38.4% 38.2% None 0_1ins930;452G>A n/a
2 ccsbBroad304_16151 pLX_304 0% 38.4% 38.2% V5 0_1ins930;452G>A n/a
Download CSV