Transcript: Human NM_001257966.1

Homo sapiens crumbs cell polarity complex component 1 (CRB1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CRB1 (23418)
Length:
3416
CDS:
210..2822

Additional Resources:

NCBI RefSeq record:
NM_001257966.1
NBCI Gene record:
CRB1 (23418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001257966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055770 GCTCTGCTTAACTTCTATAAT pLKO.1 2085 CDS 100% 15.000 12.000 N CRB1 n/a
2 TRCN0000055768 CCACAATTATTCTGGTGTAAA pLKO.1 848 CDS 100% 13.200 9.240 N CRB1 n/a
3 TRCN0000055769 GCCCATTTGATAACCTTTCTA pLKO.1 1477 CDS 100% 5.625 3.938 N CRB1 n/a
4 TRCN0000055771 GCTGGAAGATTCTGTGAGATA pLKO.1 630 CDS 100% 4.950 3.465 N CRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001257966.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.